circad | circRNAs associated with diseases

Circular RNA EIF6
Gene	EIF6	Organism	Human
Genome Locus	chr20:33867368-33872594:-	Build	hg19
Disease	Thyroid carcinoma	ICD-10	Thyroid and other endocrine glands (D09.3)
DBLink	Link to database	PMID	30540564
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Five paired ATC tissues and para-carcinoma tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTCAGTGGTGGAGAGTGTCT Reverse AGTAACAAGCTCCGCACGC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Liu, F, Zhang, J, Qin, L, Yang, Z, Xiong, J, Zhang, Y, Li, R, Li, S, Wang, H, Yu, B, Zhao, W, Wang, W, Li, Z, Liu, J (2018). Circular RNA EIF6 (Hsa_circ_0060060) sponges miR-144-3p to promote the cisplatin-resistance of human thyroid carcinoma cells by autophagy regulation. Aging (Albany NY), 10, 12:3806-3820.